How can you possibly be an athiest?

[Boris Godunov]

Originally posted by Frogman


Hmmm, if thats the case its news to me. I'd like to see some info on that. I'll look at talk origins and see if they have anything but if you know a link that would help. Many species can interbreed so I would be surprised if we can show one species becoming differentiated enough to not be able to.

Try and crossbreed a Lion and a Tiger.

[Arrian]

Speer asks how someone can possibly be an atheist. I am constantly amazed at how many people on this planet aren't.

I fit into the "soft atheist" column, I suppose.

-Arrian

[Elok]

Originally posted by Boris Godunov
Try and crossbreed a Lion and a Tiger.

Or a donkey and a horse...either way the result is a sterile offspring, I believe. Right?

[Ben Kenobi]

Jack:

I don't have to PROVE any of this, because I am not trying to PROVE the non-existence of God.

Then you admit that you have no hypothesis of your own. You have been reduced to critiquing the theist's hypothesis. Thanks Jack!

ABIOGENESIS is speculation.

Why should we believe in Abiogenesis any more than in God? Why is one okay and the other not?

Ramo:

If a theory stops explaining the evidence adequately, it gets scrapped. That is exactly why I should be able to rely on it.

What happens when you find a theory that explains the evidence better than another? I would expect science to use that explanation before anything else.

Everybody:

Has anybody actually seen macroevolution?

[Elok]

How exactly *could* one see macroevolution without a time machine?

[Lincoln]

Originally posted by Jack the Bodiless

Incorrect. My position is that the first life (the first self-replicating molecule) contained the "information" necessary to reproduce itself, but that the amount of information required for this feat was small enough to arise by chance. To use your "automatic transmission" analogy: it's more like two or three of the cogs tossed in by the engineer accidentally meshing with each other in the jumble.


Incorrect. It does, however, indicate the plausibility of biological machinery operating without intelligent intervention. Again you are seeking to reverse the burden of proof.


...Huh? Evolution requires replication, and the inheritance of variable characteristics for natural selection to work with! That's why we keep pointing out the distinction between abiogenesis and evolution! But it works in non-living systems with those characteristics (computer simulations).


Incorrect. You cannot produce MUCH information from pure randomness, without a selection process allowing the accumulation of "useful" traits, which stores whatever information randomness tosses up.


First, prove that this secondary program has always been necessary for life.

Abiogenesis research is against you here. The complex supporting mechanism required for DNA replication does not appear to be necessary for RNA replication, and protein replication is even simpler. Hence the theory that DNA came later.


You cannot simply declare something to be "too improbable" without calculating the probabilities involved! If you are claiming that even a simple self-replicating molecule is too complex to form by chance, over a period of millions of years in all the world's oceans (and the oceans of all other Earthlike planets in the Universe), then show us your calculations.

Jack, by your own admission then the burden of proof is on you to produce information from randomness. That is your assertion, not mine.

The "secondary program" is simply the mechanism that actually uses the initial input. The initial input is pure gibberish unless it is translated and put to some actual use. For example the words that you are reading now make no sense unless you have an understanding of the English language. In life the appropriate parts of the translation machinery are coordinated with the string of DNA. It "knows" what the code means and translates it into the appropriate amino acid and then that amino acid is assembled in a SPECIFIED order to make a specific polypetide chain with a particular purpose. Without the secondary program you cannot produce information because a random order of DNA is not information and if we simulate a specified order (which you correctly said was contrary to evolution because there is a goal) that specified order is of no use in the experiment because it only has meaning to us. The secondary program must assign the meaning and translate it for actual use like it does in the real life process.

quote:

"That's why we keep pointing out the distinction between abiogenesis and evolution! But it works in non-living systems with those characteristics (computer simulations)."

Of course the problem is abiogenesis, not evolution because even you admit that information must be in the beginning. In any case, why don't you do an experiment like Richard Dawkins did simulating evolution and produce information? In his flawed experiment he inserted his own intelligent input (including a goal) into the program and tainted it. He also did the "natural" selecting himself using his own intelligent input. Maybe you can correct his mistakes and do it right. I might add that Dawkins also used a program that was designed by an intelligent being. So I would suggest that you do not repeat that error either. I have a critique of his "Me thinks it is like a weazel" experiment if you would like to see it.

quote:

"Abiogenesis research is against you here. The complex supporting mechanism required for DNA replication does not appear to be necessary for RNA replication, and protein replication is even simpler. Hence the theory that DNA came later."

DNA or RNA, the problem of information remains. And RNA replication is not producing information. It is simply making a copy. Now you will say next that evolution will take over here and select the best result. But what does the best replication system have to do with the evolution of the code and the information it contains? You are making gears. The problem is the assemply of those "gears" into a fully functioning, information-based machine. In other words we can make (or they can be spontanelusly formed) certain parts of a car but who would jump to the conclusion that those parts assemble themselves into a functioning auto? Many things form spontanelusly in nature (such as crystals) but these interesting patterns have nothing to do with the problem of asembly of an information-based biological machine. That functioning machine is the essense of life. It is not a God in the gaps argument that I am making but a God of the very foundation and essence of life.

quote:

"You cannot simply declare something to be "too improbable" without calculating the probabilities involved! If you are claiming that even a simple self-replicating molecule is too complex to form by chance, over a period of millions of years in all the world's oceans (and the oceans of all other Earthlike planets in the Universe), then show us your calculations."

Yes, I can declare something to be too improbable just as another poster declared that the formation of an ice cream cone over billions of years is impossible. Unless you can produce information from randomness then YOU are proposing the imposible. The are no odds to calculate because there is absolutely no evidence that it ever happened, ever. If you can demonstrate that it happened one time then I will give you the odds. And again, you cannot reason in a circle and PRESUME that "evolution did it".

I remember a point that you made earlier about information that is produced supposedly AFTER life already exists. I will answer that question in a minute.

[yavoon]

information is not produced from randomness u silly ppl. its produced by a successive string of incrimental steps governed by the laws of nature given an initial input state. if nething comes from nowhere its the laws or the intial input(the big bang) but it sure as god damn hell isnt the information.

u creationists worry me...a lot.

[yavoon]

if u ever care to read up on abiogenesis in particular u'd see wut its about. but this idea of beligerantly posting false statements in an attempt that repetition makes truth is unsettling.

[Lincoln]

Let’s assume that there is credible proof that a bee evolved from a type of house-fly. Now let’s see where the new information comes from. The DNA of both organisms is not like the contents of a hard drive (ala Provost Harrison). DNA in actual use is manipulated by the machinery of transcription and translation. For example I proposed an order of DNA previously such as:

AGCTTCCGAATCGTAAGCCTAGCT

Now let’s assume that the fly takes the first word (AGC) and puts it to efficient use. Now even in a fly the manipulation of DNA is such that what is called a “frame shift” can occur intentionally. For example the living mechanism can select the “word” GCT and ignore the first A. So in other words there is an extreme potential in even a simple animal for change. All the machinery has to do is select whatever codon word that is useful at a particular time. Also, whole “sentences” can be excised from the string of DNA. This is all part of the normal function of the information contained in all life. Now let’s assume that the fly evolves into a bee.

Where did the new information come from? Well, it certainly could have been in the original DNA couldn’t it? All it really takes is a selection of DNA letters and the proper excising of it and you can theoretically produce almost anything, just as you can select from the information I have typed here and produce something entirely different that what I just said. Simply cut out the letters and words and parts of words and see what I mean as you past them together in another order altogether. This is exactly what even the normal operation of life entails. So the potential for evolution is there regardless of the addition of new information by whatever means.

So let’s move this to a computer. My spell checker gives me new information. It informs me when a word is misspelled. So where does this new information come from? Did it arise randomly? Well in a way it did because there was no intelligent input when it informed me of the misspelled word. IT just did it on it’s own. But wait, is that true? No, of course not because the program was the result of an intelligent programmer. He allowed for the manipulation of the initial information that he programed in by way of his own intelligence. But you can prove that I am wrong simply by producing a spell check program without the aid of an intelligent being. Try it.

Therefore, there is no reason to presume that evolution has ever produce new information ever. There is no evidence to back up that assertion. Now obviously a modern organism has the potential to deal with intrusions (such as mutations or a destructive virus). Is the present reality the result of a continuing increase in information by way of mutation and natural selection? Of course not. No one proposes that evolution works that fast. The initial information allowed for the intrusion or it is manipulated because of a currently operating system to deal with the intrusion. No further input of information from an outside source is necessary. The information contained in a virus is compared within the organism and it is dealt with just as my spell checker automatically deals with everything it was prepared for.

The idea that information that is produced by the accident of mutation, and this string of accidents causes creatures to evolve from a worm-like creature to a giraffe or whatever is absurd. A frog has the potential to transform itself from a tadpole to a frog. A caterpillar has the potential to turn into a butterfly. There is no necessity to speculate about accidental mutations at all, is there?

So, to simply state that evolution proves that information arises randomly is a stretch to say the least. The best way to prove that it does arise randomly is to actually show that it does.

[yavoon]

u have no concept of the proposed theories of which u speak and are just spouting creationist babble. seroiusly, go and read what scientist are proposing is taking place. dont just be like "omg I found a hole in something I know nothing about." or repeat some tired argument u heard from somewhere else that seems to make some sort of redneck sense to u.

[Lincoln]

Originally posted by yavoon
information is not produced from randomness u silly ppl. its produced by a successive string of incrimental steps governed by the laws of nature given an initial input state. if nething comes from nowhere its the laws or the intial input(the big bang) but it sure as god damn hell isnt the information.

u creationists worry me...a lot.

I'm sorry but it was an atheist, Jack the bodiless, who aserted that infromation arises randomly. Is he a "silly atheist"?

Now why don't you give us the "sucesive string of incrimental steps that are governed by the laws of nature"?

[yavoon]

umm u can look them up. its documented. if u dont know about them then obviously u have never read nething about it.

and I dont see how I should be ur tutor. do u goto university? do u have access to their libraries? I'm sure there are also summarries of what is being proposed that are simply statements of the theory. whether u want abiogenesis or evolution.

[Lincoln]

Originally posted by yavoon
umm u can look them up. its documented. if u dont know about them then obviously u have never read nething about it.

and I dont see how I should be ur tutor. do u goto university? do u have access to their libraries? I'm sure there are also summarries of what is being proposed that are simply statements of the theory. whether u want abiogenesis or evolution.

Translation:

You don't know the "successive string of incrimental steps".

[yavoon]

wow forum became a trainwreck for a lil bit there.

chemicals-->polymers-->hypercycle-->proto-->bacteria

its something like that. really did u think i was lying? I dont understand the pt. I understand if u think that these steps didnt exist u'd call my bluff. but otherwise I think u should have good faith and indeed realize u haven't read much of nething on what u r supposedly debunking. not saying u need to read tons, but u know, brief summaries maybe some abstracts some history I dont know, sumtin.

[Lincoln]

Well thanks yavoon for posting that. But the subject is the origin of information. There is no proof there that information has come into being. That is simply an hypothesis.