How can you possibly be an athiest?

[Agathon]

Originally posted by yavoon
agathon are u saying that the laws of nature are random? or that say "living organisms came about through random chance."

cuz obviously we know nothing about why the laws act the way they do. but as for the other, we certainly know that the complexity of the universe is not random, it is due to the laws of the universe.

Smart cookie - that's the problem with the argument which I mentioned. The usual objections to it aren't good ones though. This one has more substance.

[Elok]

Uh, Jack, isn't one of the main stipulations of science that we should accept only *naturalistic* explanations of phenomena? It seems to me that science presupposes, in a way, that god does not exist, because "god made it happen" is impossible to qualify as true or false. How on earth does one scientifically prove the existence of god? I imagine, at best, something like the altar of Elijah("if the control petri plate offered to Baal does not ignite, but the sacrifice to the LORD does, ye shall pay homage to thy god."). Which, of course, is another problem, because if God did exist His personal desire would be a naturally uncontrollable variable, and you cannot so far as I know have more than one of those in a scientifically valid test. I can't explain why god would choose not to show himself, but that doesn't mean he could not ostensibly have one. I don't see how there could be real, solid "evidence" at all, one way or another.

[yavoon]

rogan obviously newtonian mechanics is the inverse of relativity. u might have a nitpick that I named the wrong half(the theory that supplanted the original cuz it doesn't work everywhere instead of the original). but otherwise, meh.

and I fail to see how us naming a theory "the theory of everything" and then it somehow not describing everything proves nething but the fact that we misnamed it!

[yavoon]

elok science presupposes nothing of the kind, science only stipulates that ur claims be provable in a rigorous and methodical way.

a lot of u miss the specifics of science w/ the goals of science. if there was a way to work w/in this realm u call the "spiritual" in a reliable and rigorous way SCIENCE WOULD BE GLAD TO. but u simply can't say this realm exists, then say that we can't enter it. all the while giving no proof. its like defining urself far enuff away from science so u dont have to worry about it.

the only reason science doesn't go around investigating and experimenting on the spiritual(by in large) is there's no compelling reason to.

[Lincoln]

Originally posted by Jack the Bodiless

Evolution inevitably creates information from randomness. That isn't in dispute even by most creationists (even though they call it "microevolution"). Only the most fanatical argue that beneficial mutations never occur or that natural selection does not exist.


I have already stated my belief that the first self-replicator would be something simple enough to form by chance. However, YOU keep referring to a system that has undergone billions of years of evolution (the modern genetic code).


Incorrect. The dancing of bees (signalling the whereabouts of food to other bees in the hive) is a code that wasn't intelligently designed by the bees, for instance (they lack the brainpower). That's another code developed by evolution.

But there are no "similar codes" to the genetic code. There are no really close manmade examples, except computer simulations of evolution itself.


No it is relevant. What matters is the (initially random) formation of molecules of the right SHAPE. Everything else stems from that: the refinement of methods of reproducing the "right" shapes.


If we're going to stick to this point, we must drop discussion of the modern genetic code. Unless you can prove that the modern code was essential to all life from the outset?


Even the simpest modern life is the end result of at least three billion years of evolution. Any organisms still using a simpler, more primitive, less efficient system would have been driven into extinction long ago.

Yes, this is speculation. But if it MIGHT have happened this way, then there is no "problem" for atheism.


We have plenty of evidence for evolution, and no evidence for the existence of the "intelligent designer". While such a designer MIGHT exist, he/she/it remains an unnecessary assumption at this time.

Evolution has not been shown to produce information without intelligent intervention. The only way that you can conclude that it has is if you have completely and absolutely eliminated intelligent design from consideration. That is called circular reasoning, and it is an indication of your unfailing faith in materalism regardless of evidence to the contrary. You are reasoning from a belief system. You are not being objective at all. If a certain organism changes over time with the appropriate increase in information then you cannot say that "evolution did it" unless you have already determined that information arises by random means or that there has never been any intelligent intervention ever. That would be a statement of faith (unless you can prove here that information does arise randomly).

quote:

"YOU keep referring to a system that has undergone billions of years of evolution (the modern genetic code)."

Another statement of faith. You have faith that life was not based on information and a genetic code at the beginning. Please tell me why I should regard your belief as anything more than speculation? You again assume that "evolution" made something out of nothing with no proof. Where are your fossils, your living examples, your lab-created life forms? You have nothing but your guess to back your statement. YOU are making an unwarented assumption here. I am simply looking at the evidence of ALL LIFE ON THIS PLANET. Your presumption is simply science fiction without substance.

Your "dancing of bees" argument is more circular reasoning. Bees are obviously the result of either creation or evolution from a lower life form. How does the fact that they contain information (as evidenced by their language in the dance) prove your point? If you say that "evolution did it" then that is simply another statement of faith in materalism. If the present creation, whether evolved or not, is the product of an intelligent designer then the dancing of bees is merely more of a reflection of the information that originated by the creator of that information. You still must prove here that information arises from randomness according to the laws of physics only. If you think that "evolution" can do it then the burden of proof is on you to prove:

1. Life at one time did not contain information.

2. The method or vehicle whereby the code evolved along with the specified information it codifies.

3. How the translation system evolved in coordination with the code.

4. Why one order of DNA (or RNA) would be selected above another before the proto-life knew what the code was or how it was to be translated.

5. Why one code would be selected over another before the translation was known by all parts of the evolving biological machinery.

That is just a start but I will save the rest for later.

quote:

"Yes, this is speculation. But if it MIGHT have happened this way, then there is no "problem" for atheism."

Thanks for the honesty. Your belief is based upon what "might" have happened without evidence to back it up. You and I both have faith but at least mine is based upon available evidence. Yours defies that available evidence and is based purely on speculation that contradicts the obvious source of information, i.e., an intelligent being. Please answer the questions. You seem to be dancing around them.

[Lincoln]

Here is an excerpt from my book that might help you to set up an experiment to prove me wrong:

The foundation of all life is contained in specific detailed instructions and information that can be read, interpreted, understood and acted upon logically. This type of information cannot arise without intelligent input. Let’s spell out the problem and the proposed solution so that the skeptic can experiment on his own to prove me wrong. DNA and/or RNA gives specific instructions that are in some ways similar to the instructions that a worker might follow as he builds and operates a machine. I will write some instructions which are similar to a fraction of one percent of the instructions contained in a simple, single celled organism and then I will present the problem.

“The completed organism is to be simply one cell. First assemble the RNA molecule so that the ribosomes can interpret the completed instructions. Next begin making the various amino acids. Then arrange them in such a way that they form useful proteins. After those steps are completed then devise a system whereby the RNA can cut itself into pieces. Devise a means whereby these pieces only use the specific information that is needed at a particular time. Now take those pieces of information and splice them together at various times as needed within the cell. Devise a way whereby the ribosomes can come into existence to process the information that is initially necessary for their existence. Finally, cause all of the appropriate parts of the cell to form themselves and replicate themselves in an orderly fashion so that the initial life is able to make and maintain the parts that are necessary to make and maintain and regulate the parts necessary to make the initial parts and the associated machinery that is necessary to make the parts initially out of parts that the initial machines make.”

Now here is the problem. Use any system that you choose, whether it is monkeys typing randomly on billions of typewriters for billions of years, or powerful computers or whatever you want, and produce the above paragraph without intelligent input. Of course a human being will be allowed to set up the experiment but he may not intervene once it is underway. If you use a computer there cannot be a goal entered into the computer and there cannot be value judgements entered into the program because this takes intelligent input and will taint the experiment. The alphabet should be randomly entered into the program along with punctuation marks and spaces but we must stop there as further interference would make the results of our experiment useless in solving the problem. Now run this random program as long as you want on as many computers as you choose and see if the result is ever the above paragraph. Be sure to keep accurate records of each step of the program that you devise so that it can be readily duplicated and tested. That way the public will not be tricked again by intelligent input under the guise of natural processes. After you have solved the problem return to this book and read the following paragraph. NOT NOW!! YOU HAVEN’T SOLVED THE FIRST PROBLEM YET!!

Okay good. Now make the instructions actually do something. Insert the paragraph into another computer and see what it does with the "information." I think that you will find that even if the complete instructions arose randomly, defying fantastic odds, that it is impossible to use them, without intelligent input. You will need not one miracle but several in order to inform the appropriate parts of the translation mechanism on the meaning and correct use of the words. There is no logical path from the randomly generated "instructions" to actual work without intelligent intervention. Because information is absolutely essential for even the most basic life form there is no logical path to life without the preexistence of an intelligent being.

Now let’s illustrate the problem. We will assume that the basic information is reduced to code. We can take the actual DNA from a living organism to make sure that we get it right. The instructions will look something like this: AATAACCGCAGGTCTTCAGCCGATATTGACTAGGTC etc. The first problem will be to determine how the code is divided into triplets (codon “words”). Notice that if we start with the first A the first “word” will be AAT. But if the real information should begin with the second A then the first word is ATA. If we begin in the wrong place then all we have is gibberish. For example read one of the sentences that I have written here but ignore the spaces between words. Now remove the first letter and read it. As you can see it is very important that the nascent life form that we are creating knows where the instructions begin and how the actual words are divided correctly into the codon words with a correct understanding of the grammatical structure etc. So how will this first life-form know where to begin? And how will it know to divide the string of DNA into triplets? And how will it know that a triplet is advantageous before it even "knows" what the code is or the other possible alternatives for coding the information?

In real life the codons are divided by a complicated process that effectively uses the information it correctly gathers from the string of DNA. There really is no code without the accompanying translation machinery that discerns the triplets from the endless string of letters. The machinery must exist before the information can exist. And the string of DNA is useless unless it is correctly translated by preexisting translation machinery. The code is manifest by way of specified enzymes that contain information themselves. This information is coordinated with the string of DNA so that the correct three-letter words are used at the correct time and place. So we must not only have the DNA in the exact order but the enzymes used in translation must be in a specified order to correctly manifest the information. I must also say here that these enzymes (with names like tRNA, rRNA, RNA polymerase etc.) must be of the correct shape. Like a puzzle that fits together these information carrying enzymes fit with the appropriate part in the machinery and transfer the information to another part of the machine that is prepared with the appropriate shape and information content to receive it. The code, the shapes, the information and the logistics necessary to coordinate the process and assemble the fragile parts must exist before life can even begin.

So the miracle of life must begin with a string of miracles in order to communicate the code to all of the parts of the translating machinery and in order to ensure that the correct information is used. As you can see the omission or insertion of even one letter in either the DNA or the translation machinery makes the instructions useless. The code itself came from somewhere? Where? The code was communicated to the appropriate parts of the translation machinery so that it knew what it was translating. Who did this? One miracle is not enough. We must have hundreds of miracles coming together at precise times and places in order to even produce the translation of the code! Of course we still have not created life. We still have not made even one gear in the machinery of life let alone the entire machine itself. Intelligent design is not some far fetched theory devised by a zealous creationist. It is the logical conclusion drawn by the facts and evidence. The alternative is the science fiction of atheists that is based on a string of miracles.

[yavoon]

lincoln I think u need to visit talk origins or otherwise become more informed on the scientific perspective than u currently are. cuz there's only so far u can ask a rationale person to go to chase u down.

[Elok]

Originally posted by yavoon
elok science presupposes nothing of the kind, science only stipulates that ur claims be provable in a rigorous and methodical way.
a lot of u miss the specifics of science w/ the goals of science. if there was a way to work w/in this realm u call the "spiritual" in a reliable and rigorous way SCIENCE WOULD BE GLAD TO. but u simply can't say this realm exists, then say that we can't enter it. all the while giving no proof. its like defining urself far enuff away from science so u dont have to worry about it.
the only reason science doesn't go around investigating and experimenting on the spiritual(by in large) is there's no compelling reason to.

Or because it's impossible to. You can believe that it's all a big evasion game or you can believe it's true. It's a matter of personal belief.
Or you can insist that our whole conception of reality shift so you can stick a probe up its rear and take measurements. It's still not going to happen.
And please do not make claims on behalf of the entire scientific community without checking them. What I say is perfectly true and valid. Science is not in any way the study of the supernatural because the supernatural is intrinsically non-empirical. For centuries the supernatural has therefore been assumed not to exist for the purposes of scientific discovery. (Today scientists cough and try to forget that Sir Isaac Newton was an alchemist. I agree that alchemy was a sham science; I just think it's funny) The spiritual was initially assumed to be unproveable, thus irrelevant to the purposes of science, but nowadays it's just shoved out of the way as a load of crap. It's more or less the same thing either way.
Which is what I have been trying to say this whole bloody time. Your response seems to be the usual "you're just hiding from the truth" shpiel I hear from all atheists. Not only irrelevant to the what I said, but ill-mannered. I happen to believe that there are aspects of reality outside the natural. You do not know for a fact why I believe that, or if I have a reason at all, so do not assume I am a fool.

[Lincoln]

Originally posted by yavoon
lincoln I think u need to visit talk origins or otherwise become more informed on the scientific perspective than u currently are. cuz there's only so far u can ask a rationale person to go to chase u down.

Ah yes! Talkorigins, the atheist Bible. I have read their site thoroughly, thanks. Please point me to an article that refutes what I just said.

[yavoon]

no science does not "assume it does not exist" u silly man. if u were able to somehow be rigorously prove it would be an amazing breakthrough in science. but it can't.

and I dont think scientists cough at nething, they aren't ashamed of the journey that one goes on in reference to the pursuit of knowledge and the implementation of its usefulness. I think we understand we screw things up.

and since when is the supernatural intrinsically un empirical? when the hell did that happen?! wut u really mean is wut u believe has no empirical evidence therefore it is entrinsically empirical only by its lack of evidence.

the reasons u prolly get it from so many aetheists is cuz its true. u can't define urself away from the problem. u can't makeup a god, then hide behind the fact that he can't be proved. u can't shove god into the knowledge gaps in science. u can't misuse wut science doesn't know against it. u can't assume god is unknowable as an excuse to not have to prove him. I mean it goes on n on and it starts to get more repetitive.

but basically the reason lotsa ppl giv eu flak for it is they are valid in their flak.

[yavoon]

if u can't find an article that deals w/ dna and the concept that it isnt a string of miraculous unlikely events. then u obviously haven't read it at all.

[yavoon]

oh and talk origins is no bible, its a response to the abuses of science perpetrated by creationists.

as obviously it lacks a lot of things that the bible has. like ne morality, or ne direction at all really.

[Uncle Sparky]

God made me an athiest, and I cannot go against His will.

[Ben Kenobi]

yavoon:

u can't makeup a god, then hide behind the fact that he can't be proved.

In what sense are you using the word 'proof?'

If you mean scientific proof, you have just rejected a scientific argument for the existence of God, without properly considering the evidence placed before you, and without offering another explanation equally probable to the existence of God.

u can't shove god into the knowledge gaps in science.

It is not that we are shoving God into these gaps, science itself acknowledges that it cannot answer these questions adequately.

u can't misuse wut science doesn't know against it.

It is not 'misusing' the evidence to postulate a theory explaining the evidence.

u can't assume god is unknowable as an excuse to not have to prove him.

What can we know about God? This is a big question. If one accepts the bible as accurate testimony as to the character of God, we can know a considerable amount. We will not know everything, but this is a far cry from saying that God is entirely unknowable.

What then, are the characteristics of God? He is omnipotent, omniscient, omnipresent and immortal. He is unchanging, he exists outside of time, and can see the future, and past as easily as we see the present.
He exists apart from the universe, and stands outside of the laws binding everything else.

These studies are part of Theology, which, believe it or not, used to be tagged the 'queen of sciences.'

[yavoon]

why would it shock me that theology use to be called the queen of sciences? I'm not shocked about alchemy(earlier in this thread) so I dont see how theology would disturb me.

science does not acknowledge it can not answer these questions. u've simply defined the questions so science can't answer them. there is a very significant difference. science would not shy away from knowledge just cuz it was "spiritual." or some other rubbish. if its true science wants it. the problem doesn't lie w/ science's unwillingness to learn. it lies w/ religion's unwillingness to be rigorous.