Scientists create first living organism that transmits added letters in DNA 'alphabet'

[Tuberski]

They call me the mastodon cuz I got the trunk in the front.

Mastadon or Bug?

ACK!

[Sava]

Bugs have trunks?

[pchang]

Almost. Mosquitos have long probosces. Rhinoceros beetles have pretty impressive front facing appendages too.

[Sava]

rhino dick

[Ben Kenobi]

I'll make you a clone Sava dong and send it to you

Why? Has your mother finished with it?

[DaShi]

Not unless you create a whole new set of translation enzymes.

I think it would get more use in adding new aminoacids to the ~20 that are currently used.

That's the issue. These new bases don't appear to actually code for anything. Perhaps they could use it to add comments to DNA codes.


ATGGGTTACCAAATTAAGGATAT *checks if neighboring organism is same species, if not consumes*

[Tuberski]

Bugs have trunks?

VW

ACK!

[Buster Crabbe's Uncle]

Oh SNAP!

[Sava]

ngawat

[Buster Crabbe's Uncle]

It's a small trunk, Butt.

[Sava]

It is a pronoun.

[Buster Crabbe's Uncle]

But not associated with much adverb action, I hear.

[MrFun]

...and they've been throwing fits over GMO corn...

I am curious to see how weak-kneed new age hippies will react to this - positively or negatively??

[MrFun]

I tried my own experiments with creating marijuana abominations (cannibominations?), adding uranium to the potting soil, dosing them with plant growth hormones, sacrificing the blood of wild animals to Ba'al. But then I forgot to water the plants, and they withered and died.

[Buster Crabbe's Uncle]

[adds name to pothead list]