How can you possibly be an athiest?

[Urban Ranger]

Originally posted by obiwan18
As for observing macroevolution, does the lack of direct observation render this an untestable hypothesis? Is it possible to disprove macroevolution, Ramo?

Speciations have been observed, refuting this Creationist challenge.

[Jack the Bodiless]

Frogman:

A population isolated from the parent group gradually becomes unable to breed with it, as the genetic differences accumulate.


Hmmm, if thats the case its news to me. I'd like to see some info on that. I'll look at talk origins and see if they have anything but if you know a link that would help. Many species can interbreed so I would be surprised if we can show one species becoming differentiated enough to not be able to.

"Reproductive isolation" is the phrase biologists use. I found this article in a Google search on "reproductive isolation" speciation, among many others.

Lincoln:

Jack, by your own admission then the burden of proof is on you to produce information from randomness. That is your assertion, not mine.

That's easy, and uncontroversial. Evolution does it all the time (examples: evolution of antibiotic-resistance in bacteria, the Nylon Bug, and so forth). But again you need to be clear about whether you're discussing abiogenesis or evolution. I'm saying that, even without evolution, SMALL AMOUNTS of information will appear entirely at random. Try typing random letters on a keyboard: I guarantee that you will eventually get simple words like "and", "the", "fog" etc. Abiogenesis is the theory that a self-replicating molecule can be generated like this.

The "secondary program" is simply the mechanism that actually uses the initial input. The initial input is pure gibberish unless it is translated and put to some actual use. For example the words that you are reading now make no sense unless you have an understanding of the English language. In life the appropriate parts of the translation machinery are coordinated with the string of DNA...

Again, none of this is relevant to ABIOGENESIS without DNA as the replicator. You can't use the compexity of an evolved system as an argument against abiogenesis (or as an argument against evolution either, as evolution readily accounts for complexity if it's useful).

Of course the problem is abiogenesis, not evolution because even you admit that information must be in the beginning. In any case, why don't you do an experiment like Richard Dawkins did simulating evolution and produce information?

Again you seem to be having difficulty with these concepts. If abiogenesis is the problem, why should I simulate evolution?

In his flawed experiment he inserted his own intelligent input (including a goal) into the program and tainted it. He also did the "natural" selecting himself using his own intelligent input. Maybe you can correct his mistakes and do it right. I might add that Dawkins also used a program that was designed by an intelligent being. So I would suggest that you do not repeat that error either. I have a critique of his "Me thinks it is like a weazel" experiment if you would like to see it.

I've seen plenty of critiques of it. All of them are based on a misunderstanding of what Dawkins was intending to demonstrate: NOT a full computer simulation of evolution, but merely a demonstration of what a selection mechanism (in this case, an intelligent one) could do with pure randomness as input. The work of Karl Sims is a better model of evolution, with randomly-generated creatures evolving better mobility to help them in situations similar to real life (e.g. accessing "food").

DNA or RNA, the problem of information remains. And RNA replication is not producing information. It is simply making a copy. Now you will say next that evolution will take over here and select the best result. But what does the best replication system have to do with the evolution of the code and the information it contains? You are making gears. The problem is the assemply of those "gears" into a fully functioning, information-based machine. In other words we can make (or they can be spontanelusly formed) certain parts of a car but who would jump to the conclusion that those parts assemble themselves into a functioning auto?

Again you are repeating th fallacy of choosing an arbitrarily complex system for your analogy!

Please demonstrate that gears will NEVER acccidentally mesh if they're tossed into a bucket. Please demonstrate that NO simple words will ever appear when typing letters at random.

"You cannot simply declare something to be "too improbable" without calculating the probabilities involved! If you are claiming that even a simple self-replicating molecule is too complex to form by chance, over a period of millions of years in all the world's oceans (and the oceans of all other Earthlike planets in the Universe), then show us your calculations."

Yes, I can declare something to be too improbable just as another poster declared that the formation of an ice cream cone over billions of years is impossible. Unless you can produce information from randomness then YOU are proposing the imposible. The are no odds to calculate because there is absolutely no evidence that it ever happened, ever. If you can demonstrate that it happened one time then I will give you the odds. And again, you cannot reason in a circle and PRESUME that "evolution did it".

Why do you continue to repeat the blatant falsehood that there is "absolutely no evidence" for the well-known phenomenon of information coming from randomness?

Let’s assume that there is credible proof that a bee evolved from a type of house-fly. Now let’s see where the new information comes from. The DNA of both organisms is not like the contents of a hard drive (ala Provost Harrison). DNA in actual use is manipulated by the machinery of transcription and translation. For example I proposed an order of DNA previously such as:

AGCTTCCGAATCGTAAGCCTAGCT

Now let’s assume that the fly takes the first word (AGC) and puts it to efficient use. Now even in a fly the manipulation of DNA is such that what is called a "frame shift" can occur intentionally. For example the living mechanism can select the "word" GCT and ignore the first A. So in other words there is an extreme potential in even a simple animal for change. All the machinery has to do is select whatever codon word that is useful at a particular time. Also, whole "sentences" can be excised from the string of DNA. This is all part of the normal function of the information contained in all life. Now let’s assume that the fly evolves into a bee.

Where did the new information come from? Well, it certainly could have been in the original DNA couldn’t it? All it really takes is a selection of DNA letters and the proper excising of it and you can theoretically produce almost anything, just as you can select from the information I have typed here and produce something entirely different that what I just said. Simply cut out the letters and words and parts of words and see what I mean as you past them together in another order altogether. This is exactly what even the normal operation of life entails. So the potential for evolution is there regardless of the addition of new information by whatever means.

You have just answered your own question! Yes, frameshift mutations (along with all the other types of mutation, such as those which make the whole genome larger by copying chunks of it, and point-mutations which can change any letter to any other letter) can account for the appearance of traits that the parent organism didn't have. This is evolution.

So let’s move this to a computer. My spell checker gives me new information. It informs me when a word is misspelled. So where does this new information come from? Did it arise randomly? Well in a way it did because there was no intelligent input when it informed me of the misspelled word. IT just did it on it’s own. But wait, is that true? No, of course not because the program was the result of an intelligent programmer. He allowed for the manipulation of the initial information that he programed in by way of his own intelligence. But you can prove that I am wrong simply by producing a spell check program without the aid of an intelligent being. Try it.

...But now you seem to have lost the plot again. You use an intelligently-designed simulation and then complain that it was intelligently designed?

I will hereby issue another challenge. Please design a simulation for ANY natural phenomenon where the simulation is not designed by an intelligent being. Then we'll talk.

I'm sorry but it was an atheist, Jack the bodiless, who aserted that infromation arises randomly. Is he a "silly atheist"?

How many times do we need to point out the difference between SMALL AMOUNTS of "information" appearing randomly (the first self-replicating molecule, and beneficial random mutations), and the NON-random accumulation of this "information" via natural selection?

Well thanks yavoon for posting that. But the subject is the origin of information. There is no proof there that information has come into being. That is simply an hypothesis.

Again, this is not true. Information has come into being. This is an observed fact.

[Boris Godunov]

Originally posted by obiwan18
More time than we have. That is one of the problems of evolution in that we simply do not have time for random probability to form complex molecules.

Baseless assertion. How many molecules did we have, how much time did they have? When you're talking a billion billion molecules over a billion years, the odds suddenly become much better.

At any rate, you don't know the odds, so this is just unfounded.

[Lincoln]

Thanks for your post Jack. I think we are now making progress in this debate and we have even found some agreement. Fot example I do agree with your demonstration of small amounts of information arising accidently. But that is not the root of the problem is it? Yes, we can make a mistake and produce another word that may even be better than the one we thought we were typing. I thought I explained in my example that the program can manipulate information so that is no revelation. But here is the problem again:

Where did the initial program come from? Where did the code, the translation, the grammar, the syntax, symantics etc. come from? That is the source of information not a mistake made in an already operating program. You keep avoiding the question. Where did the program come from? I will answer the rest of your arguments a little later.

Urban Ranger,

Do you have a question?

[Lincoln]

Originally posted by Jack the Bodiless

Lincoln:

That's easy, and uncontroversial. Evolution does it all the time (examples: evolution of antibiotic-resistance in bacteria, the Nylon Bug, and so forth). But again you need to be clear about whether you're discussing abiogenesis or evolution. I'm saying that, even without evolution, SMALL AMOUNTS of information will appear entirely at random. Try typing random letters on a keyboard: I guarantee that you will eventually get simple words like "and", "the", "fog" etc. Abiogenesis is the theory that a self-replicating molecule can be generated like this.


Again, none of this is relevant to ABIOGENESIS without DNA as the replicator. You can't use the compexity of an evolved system as an argument against abiogenesis (or as an argument against evolution either, as evolution readily accounts for complexity if it's useful).


Again you seem to be having difficulty with these concepts. If abiogenesis is the problem, why should I simulate evolution?


I've seen plenty of critiques of it. All of them are based on a misunderstanding of what Dawkins was intending to demonstrate: NOT a full computer simulation of evolution, but merely a demonstration of what a selection mechanism (in this case, an intelligent one) could do with pure randomness as input. The work of Karl Sims is a better model of evolution, with randomly-generated creatures evolving better mobility to help them in situations similar to real life (e.g. accessing "food").


Again you are repeating th fallacy of choosing an arbitrarily complex system for your analogy!

Please demonstrate that gears will NEVER acccidentally mesh if they're tossed into a bucket. Please demonstrate that NO simple words will ever appear when typing letters at random.


Why do you continue to repeat the blatant falsehood that there is "absolutely no evidence" for the well-known phenomenon of information coming from randomness?


You have just answered your own question! Yes, frameshift mutations (along with all the other types of mutation, such as those which make the whole genome larger by copying chunks of it, and point-mutations which can change any letter to any other letter) can account for the appearance of traits that the parent organism didn't have. This is evolution.



...But now you seem to have lost the plot again. You use an intelligently-designed simulation and then complain that it was intelligently designed?

I will hereby issue another challenge. Please design a simulation for ANY natural phenomenon where the simulation is not designed by an intelligent being. Then we'll talk.


How many times do we need to point out the difference between SMALL AMOUNTS of "information" appearing randomly (the first self-replicating molecule, and beneficial random mutations), and the NON-random accumulation of this "information" via natural selection?


Again, this is not true. Information has come into being. This is an observed fact.

The "nylon bug" argument refutes nothing I have said. The potential for variation within a species is well known as I demonstrated. Also, some frame shifts in a normally operating organism are part of the normal process. There is no reason to assume that the ability of a bacteria to adapt so that it can "eat" something new that arises is the result of an accidental mutation. In fact that ability is more evidence for intelligent design.

You keep nitpicking between abiogenesis and evolution. Use whatever process that you choose and produce information from randmoness. NOT more information from an already operating system. The problem is the system not the manipulation of an already established system.

Richard Dawkins did not refute intelligent design, nor did he simulate natural selection, nor did he produce information from randomness. Whatever he set out to do he did not solve the problem we are discussing here.

There is no fallacy in choosing to solve a problem as it really exists. You seek to simplify the problem so that you can make a stab at solving it. Yes, you can build a strawman, but I am not going to help you with it.

Gears meshing are not the problem. The problem is gears meshing and placed on shafts, then set on bearings, then assembled with other gears, then cooridinated and regulated to do something uselful, then prevented from deterioriating, then making spare parts, then replicating themselves into more transmissions etc. etc. You make the argument that piece by piece construction is simply reduced to one gear meshing with another. An information-based biological machine is not explained by one gear meshing with another.

quote:

"will hereby issue another challenge. Please design a simulation for ANY natural phenomenon where the simulation is not designed by an intelligent being. Then we'll talk."

You are asking for the impossible. Kind of makes you think doesn't it? A design requires a designer. Thanks for the confirmation.

[Sava]

More time than we have. That is one of the problems of evolution in that we simply do not have time for random probability to form complex molecules.

IIRC, Life on Earth has existed for 2.5-3 billion years. That's a long time. And it's not like the DNA formed randomly. Most life on this planet has evolved due to the forever changing environment. Fish swim in water... their bodies have developed that way. The marine life that didn't develop to swim efficiently in water were killed by predators and didn't reproduce.

Every single life form I can think of has evolved to suit the environment it lives in.

[Sava]

Where did the initial program come from? Where did the code, the translation, the grammar, the syntax, symantics etc. come from? That is the source of information not a mistake made in an already operating program. You keep avoiding the question. Where did the program come from? I will answer the rest of your arguments a little later.

Particles of matter react with other particles of matter. It's just nature Lincoln. Why do you have such a problem with understanding this? Some chemicals are flammable, some are not. That's just the way it is. In fact, I think its a major cop out to just conclude that somebody had to have designed it.

[Urban Ranger]

Originally posted by Lincoln
Urban Ranger,

Do you have a question?

I am still waiting for you to answer those in "The Great Information Debate" thread.

[Lincoln]

Well I didnt't "just" conclude that. That conclusion came from researcing empirical evidence as opposed to the ideas or theories of anyone. Did you read this thread?

[Lincoln]

Originally posted by Urban Ranger


I am still waiting for you to answer those in "The Great Information Debate" thread.

Please be real UR. I have answered all the relevant questions. If you think that I haven't then re-ask it here so we know what you are talkig about.

[Sava]

Originally posted by Lincoln
Well I didnt't "just" conclude that. That conclusion came from researcing empirical evidence as opposed to the ideas or theories of anyone. Did you read this thread?

You had your conclusion formed before you looked at the empirical evidence. Saying you believe in God is fine... but saying you believe him because there is evidence... well... is plain wrong (short of talking to a burning bush).

[Lincoln]

Not exactly. Yes, I did believe in God before I began the research because of other evidence of a spiritual nature. But the search for intelligent design in life is based upon evidence that is availale for all to see. Why don't you look into it?

[Sava]

I went through Bio, AP Bio, in high-school then AP Bio at DePaul. I didn't see anything to suggest "Intelligent Design". In fact, quite the opposite. It's easy to look at numbers and dismiss them, but I don't think that a lot of people understand, I mean truly understand the sheer size of them. There have been billions of species that have developed over billions of years. Maybe if out of the abyss, human beings just appeared, then I'd give the argument some merit. But as it stands now, it's more likely that a pink-unicorn lives behind the moon.

I'm one of those "soft" atheists. I don't believe that there is NO God or higher power. I just don't see any evidence of one in the real world. Perhaps when we die there will be something, but hey, that's for when we die. We're alive now, we should use our senses to understand the physical world; use responsible methods to form theories and laws; and not jump to conclusions.

I'm just curious, what is your background in biology? The theories that I tend to think have merit, like evolution and such, were formed by people who have done scientific experiments, seen the evidence, and devoted their lives to discovering facts objectively, and no offense, but you are not exactly an objective source.

[Lincoln]

Well I have never refuted evolution though I do not see it as the beginning and end of all life. And of course I am not the epotome of objectivity. Who is -- a materialist?

Anyway, I am in no way opposed to the facts as they present themselves in the study of biology. It is the interpretation of those facts that should be explored. I don't think that only atheists should interpret them, do you?

[Jack the Bodiless]

Where did the initial program come from? Where did the code, the translation, the grammar, the syntax, symantics etc. come from? That is the source of information not a mistake made in an already operating program. You keep avoiding the question. Where did the program come from? I will answer the rest of your arguments a little later.

Lincoln, if you're talking about an INITIAL program, and rejecting a "mistake in an already operating program", then you are talking about ABIOGENESIS, not EVOLUTION. And if DNA and its accompanying machinery is a product of evolution, then you're talking about PRE-DNA REPLICATION.

There is no translation. There is no grammar. There is no syntax. There are no semantics. Not at this stage. The self-replicating molecule needs none of that.

In fact, language is a useful analogy for evolution. Nowadays we construct sentences, for which we need nouns, verbs, the education of our kids to understand the rules of grammar, and so forth. But none of this was initially necessary for vocal communication. If Ug the Erectus notices a leopard stalking his brother Zug, they don't have to sit down and figure out a language to convey that information in a structured manner: screaming and pointing will do fine.

Assuming protein replication, the primal self-replicating molecule merely attracts free-floating amino acids from the "primordial soup". They stick, with each amino acid in the protein attracting the equivalent one from the soup, so that a new chain of amino acids (a protein) forms, that's identical to the previous one. Then they drift apart, and the process resumes with more "soup".

I've already mentioned a somewhat similar modern example: prion diseases. It's equivalent except that the "food" is already strung together into a prion protein. The mutated prion attracts the normal one and puts a "kink" into it. When they drift apart, both kinked prions continue the process within the "soup" of normal prions in the unfortunate victim's brain. As with abiogenesis, a protein with a particular configuation is causing the production of more proteins with the same configuration: without translation, grammar, syntax, semantics...

The "nylon bug" argument refutes nothing I have said. The potential for variation within a species is well known as I demonstrated. Also, some frame shifts in a normally operating organism are part of the normal process. There is no reason to assume that the ability of a bacteria to adapt so that it can "eat" something new that arises is the result of an accidental mutation. In fact that ability is more evidence for intelligent design.

There is no reason to assume that this was NOT an accidental mutation. Just as there is no reason to assume divine intervention when an apple falls from a tree.

Most mutations are either neutral or harmful. Is this evidence that God is malicious? Why credit God with beneficial mutations if you're not going to blame him for all the others? How can you treat beneficial mutations as evidence of God when you're being so biased?

You keep nitpicking between abiogenesis and evolution. Use whatever process that you choose and produce information from randmoness. NOT more information from an already operating system. The problem is the system not the manipulation of an already established system.

I can, and have, done both. Pure randomness without natural selection (analogous to abiogenesis) produces short words in random letters typed on a keyboard, and evolution produces information from randomness via random mutation and natural selection (and in computer simulations such as those of Karl Sims, which aren't based on intelligent selection from the progeny).

Gears meshing are not the problem. The problem is gears meshing and placed on shafts, then set on bearings, then assembled with other gears, then cooridinated and regulated to do something uselful, then prevented from deterioriating, then making spare parts, then replicating themselves into more transmissions etc. etc. You make the argument that piece by piece construction is simply reduced to one gear meshing with another. An information-based biological machine is not explained by one gear meshing with another.

Again you're using an over-complex analogy. It can apply only to abiogenesis, NOT evolution, because you're not simulating natural selection at all.

So let's assume that you have a bundle of gears, wheels and shafts, but they're all magnetic (just as organic molecules tend to attract each other). They stick together in a jumbled heap. After countless trillions of attempts, success will be achieved if you get a wheeled structure that rolls (not an automatic transmission).

This seems quite feasible.

Evolution would involve randomly tinkering with the structure over billions of years and keeping every change that makes it better. Eventually, you'll get an automatic trasmission (if that is "better" in this context).

Again, this seems feasible.

Did the first wheeled vehicle have an automatic transmission? No, but it "worked" regardless. That's the flaw in your analogy.

"will hereby issue another challenge. Please design a simulation for ANY natural phenomenon where the simulation is not designed by an intelligent being. Then we'll talk."

You are asking for the impossible. Kind of makes you think doesn't it? A design requires a designer. Thanks for the confirmation.

Yes, I am asking for the impossible. Just as YOU were, in seeking a computer simulation that wasn't "tainted" by intelligence. I hope this illustrates your fallacy. Do you argue that computer simulations of the weather are worthless because they're "tainted" by intelligence, or is this sort of fuzzy thinking reserved only for evolution?

Not exactly. Yes, I did believe in God before I began the research because of other evidence of a spiritual nature. But the search for intelligent design in life is based upon evidence that is availale for all to see. Why don't you look into it?

The creation of "information" via evolution is based upon evidence that is available for all to see. Why don't you look into it?