Warning: Undefined array key "birthday" in phar://.../vb/vb.phar/api/notice.php on line 1 Why God??!! - Apolyton Civilization Site

Announcement

Collapse
No announcement yet.

Why God??!!

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • Oh, I answered his wuestion Boris Sorry you missed it:

    No, there only needs to be an intelligent source in order to assign meaning. If the code is intended for use by a machine then the intention is satisfied if the machine works. This is pragmatics pure and simple. Anyway we have gone over this about 4 or 5 times so why waste more thread space going over it again.

    Sorry that you all lost that debate. Maybe you can search the archives for one that you won.

    Comment




    • Only you could be so arrogant to expect anyone to believe the claim you "won" that debate. Yes, it's been done over and over, because you continued to evade the questions and just mindlessly repeat your mantra. Loinburger pwned you so bad, it must hurt. He already tore apart that answer just a few posts below it.
      Tutto nel mondo è burla

      Comment


      • Maybe your laughing smile proves that you really won it. If all else fails post a smile and voila! You win! Anyway, I have an idea. Why don't you try to win this one instead of referring to a 500 post thread where I explained my position and answered all the questions posed several times.

        You want to redefine information to escape the obvious conclusion of intelligent input. A clever but dishonest tactic. Why don't you solve the actual problem as I stared it in a previous page?

        Comment


        • In case you missed the problem Boris:

          I will write some instructions which are similar to a fraction of one percent of the instructions contained in a simple, single celled organism and then I will present the problem.

          “The completed organism is to be simply one cell. First assemble the RNA molecule so that the ribosomes can interpret the completed instructions. Next begin making the various amino acids. Then arrange them in such a way that they form useful proteins. After those steps are completed then devise a system whereby the RNA can cut itself into pieces. Devise a means whereby these pieces only use the specific information that is needed at a particular time. Now take those pieces of information and splice them together at various times as needed within the cell. Devise a way whereby the ribosomes can come into existence to process the information that is initially necessary for their existence. Finally, cause all of the appropriate parts of the cell to form themselves and replicate themselves in an orderly fashion so that the initial life is able to make and maintain the parts that are necessary to make and maintain and regulate the parts necessary to make the initial parts and the associated machinery that is necessary to make the parts initially out of parts that the initial machines make.”

          Now here is the problem. Use any system that you choose, whether it is monkeys typing randomly on billions of typewriters for billions of years, or powerful computers or whatever you want, and produce the above paragraph without intelligent input. Of course a human being will be allowed to set up the experiment but he may not intervene once it is underway. If you use a computer there cannot be a goal entered into the computer and there cannot be value judgements entered into the program because this takes intelligent input and will taint the experiment. The alphabet should be randomly entered into the program along with punctuation marks and spaces but we must stop there as further interference would make the results of our experiment useless in solving the problem. Now run this random program as long as you want on as many computers as you choose and see if the result is ever the above paragraph. Be sure to keep accurate records of each step of the program that you devise so that it can be readily duplicated and tested. That way the public will not be tricked again by intelligent input under the guise of natural processes. After you have solved the problem return to this book and read the following paragraph. NOT NOW!! YOU HAVEN’T SOLVED THE FIRST PROBLEM YET!!

          Okay good. Now make the instructions actually do something. Insert the paragraph into another computer and see what it does with the “information.” I think that you will find that even if the complete instructions arose randomly, defying fantastic odds, that it is impossible to use them, without intelligent input. You will need not one miracle but several in order to inform the appropriate parts of the translation mechanism on the meaning and correct use of the words. There is no logical path from the randomly generated “instructions” to actual work without intelligent intervention. Because information is absolutely essential for even the most basic life form there is no logical path to life without the preexistence of an intelligent being.

          Now let’s illustrate the problem. We will assume that the basic information is reduced to code. We can take the actual DNA from a living organism to make sure that we get it right. The instructions will look something like this:

          AATAACCGCAGGTCTTCAGCCGATATTGACTAGGTC etc. The first problem will be to determine how the code is divided into triplets (codon “words”). Notice that if we start with the first A the first “word” will be AAT. But if the real information should begin with the second A then the first word is ATA. If we begin in the wrong place then all we have is gibberish. For example read one of the sentences that I have written here but ignore the spaces between words. Now remove the first letter and read it. As you can see it is very important that the nascent life form that we are creating knows where the instructions begin and how the actual words are divided correctly into the codon words with a correct understanding of the grammatical structure etc. So how will this first life-form know where to begin? And how will it know to divide the string of DNA into triplets? And how will it know that a triplet is advantageous before it even “knows” what the code is or the other possible alternatives for coding the information?



          In real life the codons are divided by a complicated process that effectively uses the information it correctly gathers from the string of DNA. There really is no code without the accompanying translation machinery that discerns the triplets from the endless string of letters. The machinery must exist before the information can exist. And the string of DNA is useless unless it is correctly translated by preexisting translation machinery. The code is manifest by way of specified enzymes that contain information themselves. This information is coordinated with the string of DNA so that the correct three-letter words are used at the correct time and place. So we must not only have the DNA in the exact order but the enzymes used in translation must be in a specified order to correctly manifest the information. I must also say here that these enzymes (with names like tRNA, rRNA, RNA polymerase etc.) must be of the correct shape. Like a puzzle that fits together these information carrying enzymes fit with the appropriate part in the machinery and transfer the information to another part of the machine that is prepared with the appropriate shape and information content to receive it. The code, the shapes, the information and the logistics necessary to coordinate the process and assemble the fragile parts must exist before life can even begin.



          So the miracle of life must begin with a string of miracles in order to communicate the code to all of the parts of the translating machinery and in order to ensure that the correct information is used. As you can see the omission or insertion of even one letter in either the DNA or the translation machinery makes the instructions useless. The code itself came from somewhere? Where? The code was communicated to the appropriate parts of the translation machinery so that it knew what it was translating. Who did this? One miracle is not enough. We must have hundreds of miracles coming together at precise times and places in order to even produce the translation of the code! Of course we still have not created life. We still have not made even one gear in the machinery of life let alone the entire machine itself. Intelligent design is not some far fetched theory devised by a zealous creationist. It is the logical conclusion drawn by the facts and evidence. The alternative is the science fiction of atheists that is based on a string of miracles.

          Comment


          • You can lie all you want about your performance in that thread (like you lied about loinburger's position on robots), but the thread speaks for itself. Maybe you're just too dumb to realize that you didn't answer the questions but just evaded the issue, but I think it's more willful intellectual dishonesty.

            I'm not redifining information, you're presenting a blatantly false impression of the role of DNA as being something that bears information, when all it bears is data. Information is not contained in DNA -- it's a molecule. It delivers electric signals to other molecules. It's called chemistry. Is it very complex chemistry? Yes. But that's thanks to millions upon millions of years of evolution. But the root of it is still basic chemistry. Not information.

            Your argument is nothing more than Behe's Irreducible Complexity, and it's bull****. DNA didn't magically appear, it developed gradually over a long time in step-by-step processes. Saying the "interpreter" would be useless without the whole is the same argument Behe used for the flagella, and it's just wrong. Biology is rife with examples of biological structures being co-opted into new roles, performing hybrid functions, etc.

            So once again, you're back to "I don't believe it could be possible, so it must not be." Argument from Incredulity. Congratulations on flunking logic 101.
            Tutto nel mondo è burla

            Comment


            • Please, just solve the problem are you can call Loingurger to help you. HEY LOINBURGER!! BORIS NEEDS YOU OVER HERE!!

              Comment


              • Here Boris. Just start with this paragraph. I am making it as easy as I can for you:

                ....AATAACCGCAGGTCTTCAGCCGATATTGACTAGGTC etc. The first problem will be to determine how the code is divided into triplets (codon “words”). Notice that if we start with the first A the first “word” will be AAT. But if the real information should begin with the second A then the first word is ATA. If we begin in the wrong place then all we have is gibberish. For example read one of the sentences that I have written here but ignore the spaces between words. Now remove the first letter and read it. As you can see it is very important that the nascent life form that we are creating knows where the instructions begin and how the actual words are divided correctly into the codon words with a correct understanding of the grammatical structure etc. So how will this first life-form know where to begin? And how will it know to divide the string of DNA into triplets? And how will it know that a triplet is advantageous before it even “knows” what the code is or the other possible alternatives for coding the information?

                Comment


                • Originally posted by Boris Godunov

                  DNA didn't magically appear, it developed gradually over a long time in step-by-step processes.
                  Please show us the steps. Or are you Telling us essentially that anything is possible given enough time?

                  Comment


                  • You all miss the point - the authenticity of the gospels is to be found in the perfection of the stories as revealed truth.

                    What I mean is, the stories and parables, be they written or passed down by worth of mouth, are so perfect and satisfying they speak to us of their supernatural and divine inspiration.

                    You can take almost any gospel story and find endless levels of meaning. These are not ordinary stories in the sense of fiction which somebody just "made up". They are deeply meaningful, like diamonds with many facets. They have extraordinary transformative power stored in them.

                    You can hear them again and again and always find something new. Take the good samaritan, or the prodigal son or the feeding of the 5 thousand. There is no end to the meanings. They have an extraordinary energy and each generation finds meaning in them. Even little incidents within the stories have deep and universal meaning - like the father straining to see his prodigal son returning in the distance - like a speck on the horizon - how moving is that little scene if you think about it? How he recognises his lost son "when he was still a long way off" and runs to meet his son. And yet it's just a tiny moment, a fragment of text, in the gospels. It's just so deep.

                    The other thing is there are so many of these stories and they all have this characteristic of a profundity almost beyond human comprehension. Food for the soul.

                    The other thing I would say about them is their accessibility - even a child can discern the meanings and yet so can a learned professor. Both are given words to live by hearing the same tale. Not many books like that.
                    Any views I may express here are personal and certainly do not in any way reflect the views of my employer. Tis the rising of the moon..

                    Look, I just don't anymore, okay?

                    Comment


                    • Thanks Horse. I agree with you. The Bible is one of the most hated and loved books on earth.

                      Comment


                      • Where is the smilie, Horse? For a second, I thought you were serious.
                        "I have been reading up on the universe and have come to the conclusion that the universe is a good thing." -- Dissident
                        "I never had the need to have a boner." -- Dissident
                        "I have never cut off my penis when I was upset over a girl." -- Dis

                        Comment


                        • Originally posted by Lincoln
                          Thanks Horse. I agree with you. The Bible is one of the most hated and loved books on earth.
                          Well I think the wonderful thing is you and I probably have very different beliefs in some areas but we are both nourished by the same gospels, like every Christian. All Christians deeply deeply love those stories like you cannot put it into words and we find a truth and beauty in them that speak to us of God's reality and love and presence in our lives today. It's a kind of truth we can hardly explain to those who don't believe, but it's so real. Who cares how they were recorded? They must have got it right somehow.

                          I never tire of hearing the gospels and I'm nobody's fool. I find a depth and perfection and pure goodness in them that I can't explain.
                          Any views I may express here are personal and certainly do not in any way reflect the views of my employer. Tis the rising of the moon..

                          Look, I just don't anymore, okay?

                          Comment


                          • Well with your encouraging words Horse I am going to bed. I have studied the Bible for about 25 years now and I always find something new in it that is relevant to this life today. Thanks again and good night (or morning I guess in Australia).

                            Comment


                            • Nighty night Lincoln.
                              Any views I may express here are personal and certainly do not in any way reflect the views of my employer. Tis the rising of the moon..

                              Look, I just don't anymore, okay?

                              Comment


                              • I don't know why I do this anymore...

                                AH

                                People find just as much meaning in Hindu Scriptures, Daoist Scriptures, Jewish Scriptures, Muslim Scriptures. Why do Christian ones prevail?

                                Lincoln

                                The reason he won't solve your problem is because he believes it does not need to be solved. You have created a problem based on what he thinks are false assumptions, and therefore the problem does not actually exist.

                                This is the point. All we are able to observe is DNA performing its function at its most complex and advanced level. We do not have the ability to see the precursors to this, because one of two things happened to those precursors.

                                First, the original forms of genetic material did not develop into self-sustaining molecules, and thus they disappeared, as they were incapable of continuing.

                                Or, there are the ones that did manage to become self-sustaining. These ones then, of course, evolved, and became the much more complex things that we see today.
                                Click here if you're having trouble sleeping.
                                "We confess our little faults to persuade people that we have no large ones." - François de La Rochefoucauld

                                Comment

                                Working...
                                X