Why God??!!

[Spiffor]

Originally posted by Dr Strangelove
One can always ask where the stuff that went "bang" came from.

You mean, thunder?

sorry that was the question to the skeptics 300 years ago

[Lincoln]

Originally posted by Boris Godunov


Because it contains nothing new. The whole "no new information in DNA" line has been tried by Creationists for well over 20 years. It was shown to be fallacious then by actual scientists who actually understand how DNA works.

Obviously neither you nor UR has read the book. It is not about "no new information in DNA". And many "actual scientists" support my view. Yet you continue to make your unsupported claims that scientists that lean toward an intelligent design solution for the beginning of life are not real scientists. Do you think that making false statements somehow supports your view if you repeat them enough times? Read my book and get back to me, so at least you know what you are talking about.

[Starchild]

BlackKnight honey, how much do you know about Buddhism per say? Cause there's some glaring mistakes in your blurb on it right at the beginning that even I picked up on and I haven't even seriously studied the philosophy of Siddhartta that deeply.

Oh, and this above all else gets my goat:

Without God we would all be living in Sin and relishing it!

Why? Why do you believe that in the absence of a God do all acts become morally permissable? A lot of sins are either stuff that's very hard to justify beyond tradition (Fish on Fridays, don't work on the Sabbath, etc) or just common sense for a society to frown upon(stealing, murder, et al). Social stability alone is a reason not to reveal in Sin.

[Lincoln]

Here is a short excerpt from my book in case anyone is interested. Please name the "actual scientist" who has solved the problem. Remember you can use evolution or any system you choose to solve the problem and you can synthesize as many generations as it takes. Just please solve the problem without intelligent input.

The foundation of all life is contained in specific detailed instructions and information that can be read, interpreted, understood and acted upon logically. This type of information cannot arise without intelligent input. Let’s spell out the problem and the proposed solution so that the skeptic can experiment on his own to prove me wrong. DNA and/or RNA gives specific instructions that are in some ways similar to the instructions that a worker might follow as he builds and operates a machine. I will write some instructions which are similar to a fraction of one percent of the instructions contained in a simple, single celled organism and then I will present the problem.

“The completed organism is to be simply one cell. First assemble the RNA molecule so that the ribosomes can interpret the completed instructions. Next begin making the various amino acids. Then arrange them in such a way that they form useful proteins. After those steps are completed then devise a system whereby the RNA can cut itself into pieces. Devise a means whereby these pieces only use the specific information that is needed at a particular time. Now take those pieces of information and splice them together at various times as needed within the cell. Devise a way whereby the ribosomes can come into existence to process the information that is initially necessary for their existence. Finally, cause all of the appropriate parts of the cell to form themselves and replicate themselves in an orderly fashion so that the initial life is able to make and maintain the parts that are necessary to make and maintain and regulate the parts necessary to make the initial parts and the associated machinery that is necessary to make the parts initially out of parts that the initial machines make.”

Now here is the problem. Use any system that you choose, whether it is monkeys typing randomly on billions of typewriters for billions of years, or powerful computers or whatever you want, and produce the above paragraph without intelligent input. Of course a human being will be allowed to set up the experiment but he may not intervene once it is underway. If you use a computer there cannot be a goal entered into the computer and there cannot be value judgements entered into the program because this takes intelligent input and will taint the experiment. The alphabet should be randomly entered into the program along with punctuation marks and spaces but we must stop there as further interference would make the results of our experiment useless in solving the problem. Now run this random program as long as you want on as many computers as you choose and see if the result is ever the above paragraph. Be sure to keep accurate records of each step of the program that you devise so that it can be readily duplicated and tested. That way the public will not be tricked again by intelligent input under the guise of natural processes. After you have solved the problem return to this book and read the following paragraph. NOT NOW!! YOU HAVEN’T SOLVED THE FIRST PROBLEM YET!!

Okay good. Now make the instructions actually do something. Insert the paragraph into another computer and see what it does with the “information.” I think that you will find that even if the complete instructions arose randomly, defying fantastic odds, that it is impossible to use them, without intelligent input. You will need not one miracle but several in order to inform the appropriate parts of the translation mechanism on the meaning and correct use of the words. There is no logical path from the randomly generated “instructions” to actual work without intelligent intervention. Because information is absolutely essential for even the most basic life form there is no logical path to life without the preexistence of an intelligent being.

Now let’s illustrate the problem. We will assume that the basic information is reduced to code. We can take the actual DNA from a living organism to make sure that we get it right. The instructions will look something like this:

AATAACCGCAGGTCTTCAGCCGATATTGACTAGGTC etc. The first problem will be to determine how the code is divided into triplets (codon “words”). Notice that if we start with the first A the first “word” will be AAT. But if the real information should begin with the second A then the first word is ATA. If we begin in the wrong place then all we have is gibberish. For example read one of the sentences that I have written here but ignore the spaces between words. Now remove the first letter and read it. As you can see it is very important that the nascent life form that we are creating knows where the instructions begin and how the actual words are divided correctly into the codon words with a correct understanding of the grammatical structure etc. So how will this first life-form know where to begin? And how will it know to divide the string of DNA into triplets? And how will it know that a triplet is advantageous before it even “knows” what the code is or the other possible alternatives for coding the information?



In real life the codons are divided by a complicated process that effectively uses the information it correctly gathers from the string of DNA. There really is no code without the accompanying translation machinery that discerns the triplets from the endless string of letters. The machinery must exist before the information can exist. And the string of DNA is useless unless it is correctly translated by preexisting translation machinery. The code is manifest by way of specified enzymes that contain information themselves. This information is coordinated with the string of DNA so that the correct three-letter words are used at the correct time and place. So we must not only have the DNA in the exact order but the enzymes used in translation must be in a specified order to correctly manifest the information. I must also say here that these enzymes (with names like tRNA, rRNA, RNA polymerase etc.) must be of the correct shape. Like a puzzle that fits together these information carrying enzymes fit with the appropriate part in the machinery and transfer the information to another part of the machine that is prepared with the appropriate shape and information content to receive it. The code, the shapes, the information and the logistics necessary to coordinate the process and assemble the fragile parts must exist before life can even begin.



So the miracle of life must begin with a string of miracles in order to communicate the code to all of the parts of the translating machinery and in order to ensure that the correct information is used. As you can see the omission or insertion of even one letter in either the DNA or the translation machinery makes the instructions useless. The code itself came from somewhere? Where? The code was communicated to the appropriate parts of the translation machinery so that it knew what it was translating. Who did this? One miracle is not enough. We must have hundreds of miracles coming together at precise times and places in order to even produce the translation of the code! Of course we still have not created life. We still have not made even one gear in the machinery of life let alone the entire machine itself. Intelligent design is not some far fetched theory devised by a zealous creationist. It is the logical conclusion drawn by the facts and evidence. The alternative is the science fiction of atheists that is based on a string of miracles.

[Boris Godunov]

Originally posted by Lincoln
Obviously neither you nor UR has read the book. It is not about "no new information in DNA". And many "actual scientists" support my view. Yet you continue to make your unsupported claims that scientists that lean toward an intelligent design solution for the beginning of life are not real scientists.

Actual DNA experts support your view? Or are they geologists?

Regardless, this is a strawman, as I never said that scientists who believe in ID aren't real scientists. I said you weren't a scientist. Your qualifications to speak on DNA are nonexistent, and your argument, as demonstrated by your excerpt, is nothing other than an argument from incredulity that has nothing to do with scientific reality on the views of how DNA came into being.

[Lorizael]

There's something you don't realize, Lincoln. It's the fact that all we are able to observe is the successful attempts at the creation of life. So of course it's going to look like a miracle.

But think of how long it took. Think of how many failures there must have been before life actually came into being.

Though, I musn't use the word failure, as that implies a goal, which does not exist for the natural processes of the universe. Also remember that the proponents of evolution do not claim that evolution began life.

[Mart]

What if God designed evolution?
He might have created the laws of physics and chemistry the way that after 15 billion years we are here on Earth.

[Lorizael]

So what? Why is that necessary? What point is there in thinking that? This is where Occam's Razor comes into play. Here the addition of God into the equation adds nothing.

[Lincoln]

I have never seen so many pop up ads on any website. But I will try to wade through the spam here if my computer doesn't crash again. Is one pop up enough? Anyway, to the debate:

I posted no strawman. That is a real problem that really exists (although anyone is welcome to reword it or fashion it differently). The problem of the ORIGIN of information and the asociated system that is contained in all of life is not solved by any materialistic explanation. An intelligent solution is indicated not an exclusively materialistic one. The very word information means to inform. The biological machinery in all of life regardless of it's natural or supernatural origin must have been informed by someone. The laws of physics cannot create an information SYSTEM such as is contained in life.

The system is the problem not the manipulation of an already existing system. This is the elephant in the living room of modern day science that ignores the possibility of ID for the most part. As far as my credentials go I have been called a "Tennessee plow boy" by one of my detractors. So what? If you smart atheists cannot answer a simple question from a plow boy why bother with the problems that are obviously beyond your comprehension?

[Lorizael]

You're playing semantics, Lincoln. You think nature gives a **** that the word we use to describe what's inside DNA suggests intelligent design?

What you don't understand is that there were countless chemical reactions stewing around on the Earth that did not form "information". There were millions, or billions, or trillions of happenings that did not create anything that could be recognizable today.

[Arrian]

One certainly must wonder about things science cannot answer (for now, at least).

Where did the stuff that went bang come from?
How, exactly, did the "primordial soup" give rise to life - what was the spark?

Stuff like that. But none of those questions mean that God exists. They're just unanswered questions.

Thousands of years ago, people didn't understand a whole lot more, so you had the god of fire, the god of wind, the god of the sea, the god of the sun, the god of running around and jumping and stuff, and of course Simon, the god of hairdoos.

We probably won't ever figure out all of the universe's mysteries. Which is probably a good thing, since it might be boring if we knew everything.

-Arrian

[Boris Godunov]

Originally posted by Lincoln
I have never seen so many pop up ads on any website. But I will try to wade through the spam here if my computer doesn't crash again. Is one pop up enough? Anyway, to the debate:

I posted no strawman. That is a real problem that really exists (although anyone is welcome to reword it or fashion it differently). The problem of the ORIGIN of information and the asociated system that is contained in all of life is not solved by any materialistic explanation. An intelligent solution is indicated not an exclusively materialistic one. The very word information means to inform. The biological machinery in all of life regardless of it's natural or supernatural origin must have been informed by someone. The laws of physics cannot create an information SYSTEM such as is contained in life.

The strawman I referred to was your accusation that I claimed scientists who believed in ID were not real scientists, which I said nowhere.

The information argument above is simply an Argument from Personal Incredulity, and it's flawed to boot, as it is assigning a mystical defition to "information" that does not exist. The "information" in question is nothing more than the chemicals in question reacting based upon the laws of physics. You haven't adequately defined "information" at any rate. You use it without really understanding what it means in science.

TalkOrigins has already dealt with this, because the Creationist dittoheads have been repeating variations on this for ages:

http://www.talkorigins.org/origins/feedback/feb04.html

There are, in fact, a number of natural laws that give "meaning" to DNA, but first, note that "information" is not the same thing as "meaning". In information theory, a sequence of symbols has information to the extent that there is a low probability that the exact sequence would be arrived at by chance, through "noise". But if you are sending a sequence of nonsense symbols through your communication system, the signal has maximum information content, or minimum entropy, if the sequence at the sender's end is identical to the sequence at the receiver's end.
Another common sense of "information" in theoretical mathematics is that the information content of a message is the smallest compression of that message without loss - in the case of a computer file, if you can decompress it to the exact binary form it had before compression.

Meaning , on the other hand is contextual. As you clearly noted, the meaning of "dfhdsf" depends entirely on the agreed conventions of the language speakers (the users of those words). Other words can depend for their meaning on the language used - Gift in English means a present. In German it means poison. Make sure, if you give a gift to your beloved, that you are speaking English!

To say that DNA has a "meaning" is to use an analogy with language that doesn't quite work. The function of a DNA product - an enzyme or other protein - depends on the other aspects of the organism - its cells, cell structures, other genes that turn it on or off, or turn on or off other parts of the organism, and, crucially, the environment. Here is a favorite example of mine: spina bifida. The genes that cause the vertebral column to close over the spinal column properly depend critically on the presence of folic acid in the maternal diet. In some families, there are genetic tendencies to be more sensitive to lacks of that diet. Are these "genes for spina bifida" in those environments? Clearly not. But if genes have meanings, that is the meaning of those genes in that environment.

The natural laws that govern the ways genes cause organisms to develop are just the laws of physics and chemistry, to which we can add the sorting effect of natural selection. Things that capture energy, food material and so on, enabling organisms to live long enough to reproduce are the things that have "meaning" in that respect. It's some that we can only identify in retrospect.

[Mart]

Originally posted by Lorizael
So what? Why is that necessary? What point is there in thinking that? This is where Occam's Razor comes into play. Here the addition of God into the equation adds nothing.

The point is that God did not have to create our universe. Stating that because existence of God adds nothing to the equation proves that God does not exist is illogical for me. In the same manner I could say for example that existance of ... let's say Antarctica is unnecessary for me. I have never been there. All pictures I saw from there might be nothing more but a manipulation. Does it prove that Antarctica does not exist?

[Elok]

Originally posted by Boris Godunov
Actual DNA experts support your view? Or are they geologists?

Regardless, this is a strawman, as I never said that scientists who believe in ID aren't real scientists. I said you weren't a scientist. Your qualifications to speak on DNA are nonexistent, and your argument, as demonstrated by your excerpt, is nothing other than an argument from incredulity that has nothing to do with scientific reality on the views of how DNA came into being.

You're not a priest; are you forbidden to talk about theology? I know he's not an "expert," but where the possibility of a god comes into play, nobody is. If you try to apply Occam's Razor here, you conclude that God does not exist. In the same vein, Occam's Razor, "used" in that fashion, would prove that Gods did exist, hundreds of years ago. The explanation of a static charge building up in the air just complicates things horribly compared to the elegant simplicity of Thor getting POed at the Jotunn again and hurling Mjolnir...one of them seems "simpler," but so what? I don't see how his arbitrarily declaring evolution impossible because it overcomplicates things is somehow less meaningful than you guys' arbitrary declaration in the other direction. It's all unbackable assertion alike.

Oh, and Mart, Cowboy Bebop is awesome! Love the avatar!

[Boris Godunov]

Originally posted by Elok
You're not a priest; are you forbidden to talk about theology?

I haven't written a book about theology that I'm trying to hawk to people so I can dupe them out of their money. Bit of a difference.

I know he's not an "expert," but where the possibility of a god comes into play, nobody is.

It's not about god where the expertise is in question, it's about DNA. The problem is that he's setting up one big strawman argument by representing DNA code as something it isn't. This is why his lack of expertise is a problem, because he's making up a chimera he dubs "information" without even adequately defining the term.

If you try to apply Occam's Razor here, you conclude that God does not exist. In the same vein, Occam's Razor, "used" in that fashion, would prove that Gods did exist, hundreds of years ago.

Again, the critical aspect of the Razor is available information. Is there more or less information available today than in the Middle Ages?

The explanation of a static charge building up in the air just complicates things horribly compared to the elegant simplicity of Thor getting POed at the Jotunn again and hurling Mjolnir...one of them seems "simpler," but so what? I don't see how his arbitrarily declaring evolution impossible because it overcomplicates things is somehow less meaningful than you guys' arbitrary declaration in the other direction. It's all unbackable assertion alike.

This is where you're failing to understand what is meant by "simpler." Thor is not a simpler explanation, because it isn't a final one. Citing Thor as the explanation just conjures up a lot of questions that ARE more complicated. Where did he come from? What's he made of? How are the particles manipulated to make lightning? How does he have the power to do such manipulation? The list would go on and on. Saying "god did it!' isn't simple, because it leaves the exact same problem of where did god from, what's he made of, how does it precisely work, etc. The entire point of the Razor is to have as few as these questions as possible left, but citing a supernatural entity not only fails to answer the question at hand, but opens up tons more questions.

In short, citing god is simplistic (because rarely do people put much thought into that answer anyway), but not simple. It pretty much begs the question.